|
| 1 | +# blockchain/zkp_verification.py |
| 2 | + |
| 3 | +import logging |
| 4 | +from zkp_library import ZKP # Hypothetical ZKP library |
| 5 | + |
| 6 | +# Configure logging |
| 7 | +logging.basicConfig(level=logging.INFO, format='%(asctime)s - %(levelname)s - %(message)s') |
| 8 | + |
| 9 | +class ZKPVerification: |
| 10 | + def __init__(self): |
| 11 | + """ |
| 12 | + Initialize the ZKPVerification system. |
| 13 | + """ |
| 14 | + self.zkp = ZKP() # Initialize the ZKP library |
| 15 | + logging.info("ZKP Verification system initialized.") |
| 16 | + |
| 17 | + def setup(self): |
| 18 | + """ |
| 19 | + Set up the ZKP system (e.g., generate keys). |
| 20 | + """ |
| 21 | + try: |
| 22 | + self.zkp.setup() |
| 23 | + logging.info("ZKP system setup completed.") |
| 24 | + except Exception as e: |
| 25 | + logging.error(f"Failed to set up ZKP system: {e}") |
| 26 | + |
| 27 | + def generate_proof(self, secret_data): |
| 28 | + """ |
| 29 | + Generate a Zero-Knowledge Proof for the given secret data. |
| 30 | + |
| 31 | + :param secret_data: The underlying data to prove knowledge of. |
| 32 | + :return: A proof that can be used for verification. |
| 33 | + """ |
| 34 | + try: |
| 35 | + proof = self.zkp.create_proof(secret_data) |
| 36 | + logging.info("Proof generated successfully.") |
| 37 | + return proof |
| 38 | + except Exception as e: |
| 39 | + logging.error(f"Failed to generate proof: {e}") |
| 40 | + return None |
| 41 | + |
| 42 | + def verify_proof(self, proof): |
| 43 | + """ |
| 44 | + Verify the Zero-Knowledge Proof. |
| 45 | + |
| 46 | + :param proof: The proof to verify. |
| 47 | + :return: Boolean indicating whether the proof is valid. |
| 48 | + """ |
| 49 | + try: |
| 50 | + is_valid = self.zkp.verify_proof(proof) |
| 51 | + if is_valid: |
| 52 | + logging.info("Proof verified successfully.") |
| 53 | + else: |
| 54 | + logging.warning("Proof verification failed.") |
| 55 | + return is_valid |
| 56 | + except Exception as e: |
| 57 | + logging.error(f"Failed to verify proof: {e}") |
| 58 | + return False |
| 59 | + |
| 60 | +if __name__ == "__main__": |
| 61 | + # Example usage |
| 62 | + zkp_verification = ZKPVerification() |
| 63 | + |
| 64 | + # Setup the ZKP system |
| 65 | + zkp_verification.setup() |
| 66 | + |
| 67 | + # Sample secret data |
| 68 | + secret_data = { |
| 69 | + "owner": "user_001", |
| 70 | + "data_type": "DNA", |
| 71 | + "sequence": "ATCGTAGCTAGCTAGCTAGC" |
| 72 | + } |
| 73 | + |
| 74 | + # Generate proof |
| 75 | + proof = zkp_verification.generate_proof(secret_data) |
| 76 | + |
| 77 | + # Verify proof |
| 78 | + if proof: |
| 79 | + is_valid = zkp_verification.verify_proof(proof) |
| 80 | + print(f"Is the proof valid? {is_valid}") |
0 commit comments