|
| 1 | +# tokenization/token_validation.py |
| 2 | + |
| 3 | +import json |
| 4 | +import logging |
| 5 | +from zkp_library import ZKP # Hypothetical ZKP library |
| 6 | + |
| 7 | +# Configure logging |
| 8 | +logging.basicConfig(level=logging.INFO, format='%(asctime)s - %(levelname)s - %(message)s') |
| 9 | + |
| 10 | +class TokenValidator: |
| 11 | + def __init__(self): |
| 12 | + """ |
| 13 | + Initialize the TokenValidator. |
| 14 | + """ |
| 15 | + self.zkp = ZKP() # Initialize the ZKP library |
| 16 | + |
| 17 | + def generate_proof(self, token, secret_data): |
| 18 | + """ |
| 19 | + Generate a Zero-Knowledge Proof for the given token and secret data. |
| 20 | + |
| 21 | + :param token: The token to generate a proof for. |
| 22 | + :param secret_data: The underlying data associated with the token. |
| 23 | + :return: A proof that can be used for validation. |
| 24 | + """ |
| 25 | + try: |
| 26 | + proof = self.zkp.create_proof(token, secret_data) |
| 27 | + logging.info(f"Generated proof for token: {token}") |
| 28 | + return proof |
| 29 | + except Exception as e: |
| 30 | + logging.error(f"Failed to generate proof for token {token}: {e}") |
| 31 | + return None |
| 32 | + |
| 33 | + def validate_proof(self, token, proof): |
| 34 | + """ |
| 35 | + Validate the Zero-Knowledge Proof for the given token. |
| 36 | + |
| 37 | + :param token: The token to validate. |
| 38 | + :param proof: The proof to validate against the token. |
| 39 | + :return: Boolean indicating whether the proof is valid. |
| 40 | + """ |
| 41 | + try: |
| 42 | + is_valid = self.zkp.verify_proof(token, proof) |
| 43 | + if is_valid: |
| 44 | + logging.info(f"Proof validated successfully for token: {token}") |
| 45 | + else: |
| 46 | + logging.warning(f"Proof validation failed for token: {token}") |
| 47 | + return is_valid |
| 48 | + except Exception as e: |
| 49 | + logging.error(f"Failed to validate proof for token {token}: {e}") |
| 50 | + return False |
| 51 | + |
| 52 | +if __name__ == "__main__": |
| 53 | + # Example usage |
| 54 | + token_validator = TokenValidator() |
| 55 | + |
| 56 | + # Sample token and secret data |
| 57 | + token = "example_token_123456" |
| 58 | + secret_data = { |
| 59 | + "owner": "user_001", |
| 60 | + "data_type": "DNA", |
| 61 | + "sequence": "ATCGTAGCTAGCTAGCTAGC" |
| 62 | + } |
| 63 | + |
| 64 | + # Generate proof |
| 65 | + proof = token_validator.generate_proof(token, secret_data) |
| 66 | + |
| 67 | + # Validate proof |
| 68 | + if proof: |
| 69 | + is_valid = token_validator.validate_proof(token, proof) |
| 70 | + print(f"Is the proof valid? {is_valid}") |
0 commit comments